Despite the high prevalence of highly pathogenic H5N1 influenza A viruses in Indonesia, epidemiology information on seasonal human influenza is lacking. The present authors, therefore, conducted virologic surveillance in Surabaya, East Java from October 2008 to March 2010. Influenza viruses, including pandemic (H1N1) 2009 viruses, were isolated from 71 of 635 individuals tested.
Jp.bond19 [email protected] Blogger 17 1 25 tag:blogger.com,1999:blog-51019622.post. Enterprise online file sharing software. Management tool for companies to control the file transfer process.
Seasonal influenza peaked in the rainy season. Compared with seasonal influenza viruses, pandemic 2009 viruses were isolated from younger patients with milder symptoms. Given the high prevalence of H5N1 infections in humans, continued influenza surveillance is essential for pandemic preparedness. Influenza A viruses cause recurrent epidemics and pandemics; the latter stemming from new strains to which most humans do not have immunity. Pandemic viruses emerge when viruses that have acquired new HA genes, by genetic reassortment or interspecies adaptation are introduced to humans.
Reassortment occurs in a host simultaneously infected with more than one influenza virus, as occurred with the 1957 Asian H2N2, the 1968 Hong Kong H3N2, and pandemic (H1N1) 2009 viruses ( -).Avian H5N1 influenza viruses have caused outbreaks in animals and infected humans in many countries since 1997 ( ). At the same time, human influenza viruses including Hong Kong H3N2, pandemic (H1N1) 2009, influenza B, and to a very limited extent Russian H1N1 viruses, are epidemic worldwide. Reassortment between avian H5N1 and human H3N2 viruses creates hybrid viruses with substantial virulence, pandemic (H1N1) 2009 viruses reassorting even more readily with H5N1 viruses, posing a threat to public health (, ). Therefore, it is essential to monitor epidemics of seasonal and pandemic (H1N1) 2009 human viruses, particularly in countries where the prevalence of H5N1 virus is high.In Indonesia, human infections with avian H5N1 influenza virus currently total 171 cases, with 141 deaths between 2005 and 9 December, 2010 – the highest number in any country worldwide. To gain more information about human influenza epidemiology in Indonesia, we conducted surveillance in Surabaya, East Java from October 2008 to March 2010.After obtaining informed consent, we collected pharyngeal swabs from patients with influenza‐like symptoms in three hospitals in Surabaya (Karang Tembok Hospital, Dr. Soewandi Hospital, and Pucang Public Health Center) and subjected them to viral isolation and characterization at Airlangga University. This surveillance project was approved by the Ethics Committee at Kobe University Graduate School of Medicine on November 20, 2007 (approval number: 603) and the Surabaya Dr.
Soetomo Hospital ethics committee (ethical clearance No.212/Panke, KKE/XI/2010). The samples were obtained with Virocult swabs (Lakewood Biochemical, Dallas TX, USA), and suspended in PBS. To isolate virus, Madin‐Darby canine kidney cells were used, virus isolation being confirmed by using the hemagglutinin activity test. RNA from positive samples was then extracted by using the QIAamp Viral RNA Mini Kit (Qiagen K.K.‐Japan, Tokyo, Japan), and subjected to RT using Ready‐To‐Go You‐Prime First‐Strand Beads (GE Healthcare Japan, Tokyo, Japan) and PCR with Premix Taq (Takara Bio, Shiga, Japan). The viral specific primers used in RT‐PCR are shown in. Type/subtypeTarget genePrimer nameSequenceA/all subtypesAll genesU12 (for RT)5′‐AGCAAAAGCAGG‐3′MatrixA/MF5′‐ATGAGYC TTYTAAC C GAGGTC GAAAC G‐3′A/MR5′‐TGGAC AAAN C GTC TAC GC TGC AG‐3′A/Russian H1N1HAA/HAH1F5′‐AGCAAAAGCAGGGGAAAATAA‐3′A/HAH1R5′‐GCTATTTCTGGGGTGAATCT‐3′A/Hong Kong H3N2A/HAH3F5′‐AGCAAAAGCAGGGGATAATTC‐3′A/HAH3R5′‐TGC C TGAAAC C GTAC C AAC C‐3′A/pandemic (H1N1) 2009A/HAsoivF5′‐TGCATTTGGGTAAATGTAACATTG‐3′A/HAsoivR5′‐AATGTAGGATTTRCTGAKCTTTGG‐3′BB/HAF5′‐AGCAGAAGCGTTGCATTTTC‐3′B/HAR5′‐AC C AGC AATAGCTCC GAAGA‐3′. Of 635 specimens examined, 71 were confirmed as influenza‐positive (isolation rate 11.2%).
Among them, 43 samples (60.6%) were Hong Kong H3N2 viruses; 24 (33.8%) pandemic (H1N1) 2009 viruses; Russian H1N1 and influenza B viruses were 3 (4.2%) and 1 (1.4%), respectively; 2 specimens were positive for both Hong Kong H3N2 and Russian H1N1 viruses. The results of surveillance from October 2008 to March 2010 and additional information on sample collection are summarized in. No virus was isolated for three months from the end of April 2009 , pandemic (H1N1) 2009 virus first being isolated in our study in July 2009, one month after the first outbreak of this virus in Indonesia. The occurrence of seasonal influenza peaked during the rainy season of Surabaya (from November to May), consistent with previous surveillance performed mainly in Java from 1999–2003 (, ).
The age distribution of seasonal and pandemic (H1N1) 2009 influenza patients is presented in. For seasonal influenza, 24 patients (52.2%) were under age 10, 8 (17.4%) were 11–20 years old, 7 (15.2%) were 21–30 years old, 5 (10.9%) were 31–40 years old, and there was 1 patient (2.2%) in each of the 41–50 years and over 50 years age brackets. The patients infected with pandemic (H1N1) 2009 were mainly under 20 years of age (21 patients; 87.5%), while the 21–30, 31–40, and 41–50 years old age brackets were each of low proportion (1 patient each; 4.2%), with no patients in the over 50 year old group.
As shown in, the maximum body temperatures of those infected with seasonal influenza were mainly 38.0–39.4°C (84.2%), whereas patients infected with pandemic (H1N1) 2009 mainly had maximum temperatures of less than 38.4°C. 60.9% of pandemic (H1N1) 2009 patients had a maximum body temperature of less than 38.0°C. Clinical presentation was similar in seasonal influenza and pandemic (H1N1) 2009 patients, with the exception of arthralgia. Further study is needed to understand the reason for the different proportion of arthralgic patients.
![]()
These characteristics of pandemic (H1N1) 2009 virus infection, that is, younger patients and milder symptoms, have been reported by others, indicating that the features of the pandemic (H1N1) 2009 virus in Indonesia at this time were similar to those in other countries (, ). Our surveillance revealed more information about the epidemiology of human influenza, including pandemic (H1N1) 2009 virus infection, in Indonesia than was available prior to this study. Unlike in more temperate regions, it is difficult to observe clear seasonality in the occurrence of influenza in the tropics. Reports from Singapore, Vietnam, Myanmar, Cambodia, Thailand, and Indonesia have shown that in Asian tropical countries, influenza activity peaks in the rainy season (, -), consistent with our results.
Given the high incidence of human cases of H5N1 virus infection in Indonesia, it is critical to continue monitoring of human influenza in this country to ensure adequate pandemic preparedness. ACKNOWLEDGMENTSWe thank Mia I. Dewisavitry for excellent technical assistance and Susan Watson for editing the manuscript. This work is supported by the Program of Founding Research Centers for Emerging and Reemerging Infectious Diseases of the Ministry of Education, Culture, Sports, Science, and Technology, Japan, and in part by Grants‐in‐Aid for Specially Promoted Research and for Scientific Research, by ERATO (Japan Science and Technology Agency), by the National Institute of Allergy and Infectious Diseases Public Health Service research grants, USA, and by the Center for Research on Influenza Pathogenesis (CRIP) funded by the National Institute of Allergy and Infectious Diseases (Contract HHSN10C).
Banyak Grup facebook yang menawarkan cara mendapat teman padahal hal itu nihil.pada tulisan kali ini, menjelaskan bagaimana cara mnambahkan teman facebook secara cepat dan instans.caranya cukup sederhana.1. Copy semua alamat email di bawah ini2. (Pastikan facebook dalam keadaan login) Kemudian klik3. Kemudian pastekan alamat email yg sdh anda copy di kolom “KEPADA”yg terdapat pada kolom”UNDANG TEMAN BERGABUNG DI FACEBOOK”4. Masukan Pesan kamu. Apa saja kata yang menarik5. Jangan lupa tulis email anda pada kolom “BALAS” di ujung bawah tulisan email [email protected],[email protected],[email protected], [email protected],[email protected],[email protected], [email protected], [email protected],[email protected],[email protected],[email protected], [email protected].
Comments are closed.
|
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |